ganS [2018-05-04 11:42:42]

galactotriose ABC transporter, binding protein

Locus: BSU34160

Isoelectric point: 5.44

Molecular weight: 45.38 kDa

Protein length: 421 aa

Gene length: 1263 bp

Function: uptake of galactotriose

Product: galactotriose ABC transporter, binding protein

Essential: no

Synonyms: yvfK

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of galactan
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,507,253 → 3,508,518

Phenotypes of a mutant

• a ganS-ganP-ganQ-ganA-ganB mutant is impaired in the utilization of galactan PubMed

The protein

Protein family

• bacterial solute-binding protein 1 family (according to Swiss-Prot)

Paralogous protein(s)

• MdxE

Localization

• cell membrane (via GanP-GanQ) PubMed

Expression and Regulation

Operons

• Genes: ganS-ganP-ganQ-ganA-ganB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GanR: repression, PubMed, in GanR regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • induced by galactan (binding of galactobiose to GanR) PubMed
  • repressed by glucose (CcpA) PubMed

Biological materials

Mutant

• MGNA-A484 (yvfK::erm), available at the NBRP B. subtilis, Japan
• BKE34160 (ΔganS::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGATTGTCACCCTTTCG, downstream forward: _UP4_TAAAGAGAAAGCTAGATTTG
• BKK34160 (ΔganS::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGATTGTCACCCTTTCG, downstream forward: _UP4_TAAAGAGAAAGCTAGATTTG

References

Loading